Plant Physiology 161: 1903-1917 (2013)

Spatiotemporal seed development analysis provides insight into primary dormancy induction and evolution of the Lepidium DELAY OF GERMINATION1 Genes [W][OA]

Kai Graeber, Antje Voegele, Annette BŁttner-Mainik, Katja Sperber, Klaus Mummenhoff, Gerhard Leubner-Metzger

School of Biological Sciences, Plant Molecular Science and Centre for Systems and Synthetic Biology, Royal Holloway, University of London, Egham, Surrey TW20 0EX, United Kingdom (KG, AV, GLM);
Web: 'The Seed Biology Place' - www.seedbiology.eu
University of Freiburg, Faculty of Biology, Institute for Biology II, Botany/Plant Physiology, D-79104 Freiburg, Germany (KG, AV, ABM, GLM)
Universität Osnabrück, Fachbereich Biologie, Botanik, D-49069 Osnabrück, Germany (KS, KM)

Received December 24, 2012; Accepted Feburary 19, 2013; Published Feburary 20, 2013.
DOI:10.1104/pp.112.213298

Supplemental Table S2. Primer sequences used for cloning of Lepidium DOG1 gene sequences and primer pair combinations (indicated by a common letter) as used in Supplemental Table S1.

Primer name

Primer Sequence (5’-3’)

Primer pair combination

1-exFP1-DOG1

ACCAAGAGTGGATGAATTTGC

C

1-exFP2-DOG1

CGCGTACCTGATCTCAAACA

B

2-exRP2-DOG1

CGGCGACGATCTCTCATAGT

A, B, D

viPCR-FP2

ACCGGATTCGACATTATACCA

D

iPCR-RP2

CAAACCATCGATGTCACGAA

C

LoxyDOG1a FP2

TTATGCGCCGTCTTGGAACA

E

LoxyDOG1a RP2

GCAAGAAATTGGCCGCTTCG

E

LoxyDOG1b FP1

TTACGCCGGAAGAAGAGCTG

F

LoxyDOG1b RP1

TGCTTGTCGAGAGCTTGGTC

F

viPCR-FP1

CCAAAACACAAAACACAGCA

A

LesaDOG1a-FP3-wgDNA

TATGTATTTTAGAAAAATGGGATCTTC

 
LesaDOG1-FP1-GW

GAAGGAGATAGAACCATGGGATCTTCAAAGAAGAACATCG

 
LesaDOG1-RP1-GW

CTATTGCTTCTTCTCCTCCTCTCCTTTGG

 
GSP-3

AGCCACACAAAGCATAAACGA

 

Article in PDF format (2 MB)
Supplementary data file (4.9 MB)
Abstract

Fig. 1         Fig. 2         Fig. 3         Fig. 4         Fig. 5         Fig. 6         Fig. 7
Fig. S1       Fig. S2       Fig. S3      Fig. S4       Table S1    Table S2
 
© American Society of Plant Biologists
http://www.plantphysiol.org/
 

The Seed Biology Place
Copyright © Gerhard Leubner 2000
Contact: gerhard.leubner@biologie.uni-freiburg.de

Webdesign Gerhard Leubner 2000
Best viewed with browser version 4 and 800x600 pixel
This page was last updated on 2 April, 2013